DNA Profiling

Introduction

DNA profiling is the process that creates a virtually unique bar-code like pattern that can be used to identify an individual and to show who they are closely related to. There are 2 main kinds of profiling.

RFLP - Restriction fragment length polymorphism

Much of your DNA simply indicates that you are a human as opposed to a chimpanzee or even a banana. But some of the other fragments vary in shape (polymorphism) in a way that is unique to the individual. RFLP DNA profiling is the process of separating an individual's unique, polymorphic fragments from the ones that everybody has. DNA is extracted from a sample, cut into small fragments by a restriction enzyme and placed at the foot of a block of gel. Electrical current is then applied across the block causing the fragments to move into a pattern according to their length. This pattern is recorded using a radioactive marker and X ray imaging.

STR – Short tandem repeat

This is an allele specific test that can be used on much smaller samples of DNA than RFLP profiling. It relies on the polymerase chain reaction (PCR) to amplify the smaller DNA sample and the fact that each chromosome contains many sections of non-coding DNA – DNA that does not code for a protein but contains areas called short tandem repeats (STRs). Each STR contains repeats of short sequences of bases, such as GCTA in

TCTAACACATGACCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACA
TGTTCCATGATATCTTCTAACACATGACCGAGCACAT

It also produces a banded pattern that is believed to be unique to each individual.

 Applications of DNA Profiling

Bookmark this page